Methods used to reveal genetic diversity in the colonyforming prymnesiophytes Phaeocystis antarctica P globosa and P pouchetiipreliminary results

Steffi Gaebler • Paul K. Hayes • Linda K. Medlin

Received: 12 October 2005 / Accepted: 17 March 2006 / Published online: 12 April 2007 © Springer Science+Business Media B.V. 2007

Abstract Previous work on the genetic diversity of Phaeocystis used ribosomal DNA and internal transcribed spacer (ITS) sequence analyses to show that there is substantial inter- and intraspe-cific variation within the genus. First attempts to trace the biogeographical history of strains in Antarctic coastal waters were based on a comparison of ITS sequences. To gain deeper insights into the population structure and bloom dynamics of this microalga it is necessary to quantify the genetic diversity within populations of P. antarctica from different locations (i.e., each of the three major gyres in the Antarctic continental waters) and to calculate the gene flow between them. Here we describe methods to quantify genetic diversity and our preliminary results for P. antarctica in comparison to two other colonial species: P. globosa and P. pouchetii. For this study of genetic diversity, two fingerprinting techniques were used. First, amplified fragment-length polymorphisms (AFLPs) were established as a

Alfred Wegener Institute for Polar and Marine Research, Am Handelshafen 12,

27570 Bremerhaven, Germany e-mail: [email protected]

School of Biological Sciences, University of Bristol, Woodland Road, Bristol, BS8 1UG, UK

pre-screening tool to assess clone diversity and to select divergent clones prior to physiological investigations. Second, the more-powerful microsatellite markers were established to assess population structure and biogeography more accurately. Results show differences in the AFLP patterns between isolates of P. antarctica from different regions, and that a wide variety of microsatellite motifs could be obtained from the three Phaeocystis species.

Keywords AFLP • Microsatellite marker •

Phaeocystis • P. antarctica • P. globosa • P. pouchetii

Introduction

The genus Phaeocystis was erected by Lagerheim (1893/1896) to accommodate the colonial alga Tetraspora pouchetii described by Hariot in Pou-chet (1892). The newly combined species, Phaeo-cystis pouchetii, can be found in Arctic waters. Two other colonial species were described soon after that: P. globosa by Scherffel (1899, 1900) from temperate waters and P. antarctica by Karsten (1905) from the Antarctic. Kornmann (1955) expressed doubt that these species were separate and lumped up all colonial species into a single taxon Phaeocystis pouchetii. Despite physiological studies (Baumann and Jahnke 1986; Jahnke and Baumann 1986, 1987; Jahnke 1989) that confirmed the separation of these taxa, it took a molecular study (Medlin et al. 1994) to end the controversy over the validity of the three colonial species. Since that time further molecular studies using other gene loci have confirmed the separation of these taxa (Lange et al. 2002) and other species have also been included in the genus (Zin-gone et al. 1999).

Phaeocystis is known to play an important role in ecology and biogeochemistry because it is distributed worldwide and forms massive blooms. Its blooms can fix a high amount CO2 and produce a substantial amount of dimethylsulfoniopropio-nate (DMSP), which is the biological precursor of the climatically important trace gas of the atmosphere dimethylsulfide (DMS) (Smith et al. 1991; Stefels 1997; Arrigo 1999; Verity and Smetacek 1996). P. antarctica is widely distributed in the Southern Ocean where it is among the most abundant primary producers and is thus a major contributor to organic matter vertical fluxes. It is known from physiological studies from many phy-toplankton species that there is a high variability among strains for every trait examined (Wood and Leatham 1992). Thus, a study of the genetic diversity and gene flow among Phaeocystis strains around the Antarctic is both timely and necessary. To pursue this we chose two techniques to assess the genetic diversity within and among

Phaeocystis spp. One technique, amplified fragment-length polymorphisms, (AFLPs) provides a rapid means to screen the entire genome for polymorphic genetic loci as a pre-screening tool to select most divergent clones for physiological investigations, whereas analysis of microsatellite loci provides a more rigorous method by which population genetic statistics can be applied to assess the genetic diversity in populations and gene flow between them. Both of these techniques will be applied to each of the three colonial species, but we report here preliminary data to establish these techniques for P. antarctica.

Amplified fragment length polymorphism

The AFLP technique developed by Vos et al. (1995) was used as described in John et al. (2004). Genomic DNA of 48 Phaeocystis strains previously extracted in earlier studies (Medlin et al. 1994; Lange et al. 2002) was digested over night at 37°C with two restriction enzymes (EcoRI and MseI, New England BioLabs, Frankfurt a. Main, Germany). This enzyme combination consists of a rare (EcoRI, six-base-pair recognition sequence) and a frequent (MseI, four-base-pair recognition sequence) cutter. Subsequent to digestion, site-specific adapters were ligated to the ends of the restriction fragments (see Fig. 1).

Fig. 1 Schematic diagram showing the construction of the AFLP fragments (from Müller 2005)

Fig. 1 Schematic diagram showing the construction of the AFLP fragments (from Müller 2005)

To amplify a subset of DNA restriction fragments, one to six additional nucleotides can be added to the 3'-end of primers complementary to the adapter and restriction site sequences (Vos et al. 1995). With two additional polymerase chain reaction (PCR) steps, the preselective and the selective amplification, only a specific subset of fragments is amplified, so that the number of the resulting PCR products provides sufficient resolution among the strains. Too many fragments make analysis difficult, whereas too few do not provide enough resolution. A primer set with one selective nucleotide per primer for the prese-lective amplification and different numbers of selective nucleotides per primer for the selective amplification were compared (Table 1). To be able to visualize the amplification products one primer was fluorescently labelled for the second amplification (EcoRI*6Fam + NNN, Applied Biosystems, Germany). After the second amplification, the samples were electrophoresed using a capillary sequencer (ABI PRISM 3100 AVANT, Applied Biosystems, Germany). For this part of the AFLP optimization, 10 primer sets for the selective amplification were tested using only four out of the 48 different P. antarctica isolates (Table 3). In Fig. 2 eight of these primer sets are compared for the isolate P. antarctica A1-3 because two of them produced no products. For all four isolates tested it was found that fewer selective nucleotides used in the second amplification step provided better resolution. Primer set Msel + CT/EcoRI + AT seemed to be the best choice because it not only gave greater resolution of the fragment pattern from zero to 500 bp (base pairs), but also more-intense fragments (Fig. 2).

Table 1 Selective nucleotides (SN) used for selective amplification. X = these primer sets have been used

Primer MseI + SN

C CC CT

AC X

AG X

AT X

Fragment patterns for the Phaeocystis isolates were compared for this primer set (Fig. 3) and for primer set MseI + CT/EcoRI + AA (Fig. 4). Differences and similarities among the isolates were easily noted by the presence of bands shared between the isolates. Differences in the genetic fingerprints could result from their biogeographi-cal distance and the supposed gene flow around the Antarctic waters. Comparing Figs. 3 and 4 the band patterns of all isolates are distinct from one another. These differences are more clearly shown with the primer set MseI + CT/ EcoRI + AT (Fig. 3). From the fragment patterns of the P. antarctica isolates obtained with this primer set, a distance matrix (fragment presence/ absence) was manually calculated for amplification fragments of between 100 bp and 500 bp only to illustrate the similarity and differences among these four strains. Fragment lengths from 100 bp to 500 bp were arbitrarily chosen because this size range appeared to present those lengths that could be most easily scored. The presence/ absence of 41 bands was scored between these lengths. Peak heights below 200 fluorescence units (see Figs. 2, 3 and 4) were ignored: fragment lengths <100 bp were not clearly resolved. Maximum parsimony analysis of the AFLP data set (Fig. 5: PAUP, Swofford 2002) shows that genetic diversity of P. antarctica in the Antarctic region is highly variable. The isolate P. antarctica SK22 from the Antarctic circumpolar current (ACC) (Fig. 6) was defined as the outgroup based on internal transcribed spacer (ITS) sequence data (Lange et al. 2002). Isolate SK21 (Weddell Sea) and D5 (Prydz Bay) seem to be more closely related to each other than to A1-3 (Prydz Bay), which, to judge by its branch length, contains more unique fragment lengths. The divergence of A1-3 (Prydz Bay) before the divergence of SK21 (Weddell Sea) and D5 (Prydz Bay) was also recovered in the ITS analysis of Lange et al. (2002). The next step is to increase the resolution of the amplification patterns and to optimize primer sets for all Phaeocystis strains. Reproducibility of the AFLP technique must be assessed by performing replicate reactions using more than one DNA isolation from the same strain; however we have, with our limited strain analysis, recovered the same tree topology as the

Fig. 2 AFLP electropher-ograms (resolution from 50-350 base pairs) of eight different primer sets for P. antarctica A1-3 (Prydz Bay, Fig. 6)

Fig. 2 AFLP electropher-ograms (resolution from 50-350 base pairs) of eight different primer sets for P. antarctica A1-3 (Prydz Bay, Fig. 6)

ITS analysis with more strains (Lange et al. 2002).

Microsatellite markers

Total DNA was isolated from P. globosa (CCMP1528), P. pouchetii (SK 34) and P. antarctica

(SK 23) (Table 2) using a modified hexadecylt-rimethylammonium bromide (CTAB) extraction protocol (Doyle and Doyle 1990; Lange 1997). Nuclear DNA was purified by ultracentrifugation through a caesium chloride—ethidium bromide density gradient (Lange 1997). This DNA was used to create enriched microsatellite libraries

Fig. 3 AFLP electropherograms (resolution from 0-500 base pairs) of the primer set Msel + CT/EcoRI + AT for the P. antarctica isolates (Table 2)

for the three colony-forming species. The protocol for the construction of these libraries was modified slightly from that of Evans and Hayes (2004), which was based on Edwards et al. (1996). Two biotinylated microsatellite oligonucleotides Bio-GA and Bio-GT (Thermo Electron GmbH, Germany) were immobilized on magnetic beads (Dynabeads, Dynal Biotech Invitro-gen, Germany). These oligonucleotides were used to bind and capture CT and CA motifs in restriction fragments to which oligonucleotide adapters had been ligated. A second round of enrichment was achieved by recapturing postamplification Dynabead products and repeating all subsequent steps in the protocol (Evans and

Hayes 2004). Enrichment PCR fragments were cloned into TOPO vector (pCR®2.1-Topo, Invitrogen, Germany) and plasmid DNA was isolated from Escherichia coli using the mini-preparation-scale Wizard™ Minipreps DNA Purification System (Serva, Heidelberg, Germany). The resultant Miniprep DNA was washed with 70% EtOH and resuspended in H2O. Cloned fragments were directly sequenced using the BigDye® Terminator v3.1 Cycle sequencing Kit (Applied Biosystems, Germany) and the vector primer set: M13 HedgeF—5' -GTTTTCCCA GTCACGACGTTG 3'; M13 HedgeR—5'-TGA GCGGATAACAATTTCACACAG 3' (Operon, Germany).

Fig. 4 AFLP electropherograms (resolution from 0-500 base pairs) of the primer set MseI + CTEcoRI + AA for the P. antarctica isolates (Table 2)

Eighteen cloned fragments from P. antarctica and 17 cloned fragments from both P. globosa and P. pouchetii were sequenced. Of these, 14 cloned fragments from P. antarctica and nine cloned fragments from P. globosa and P. pouchetii contained repeating sequence motifs. Preliminary results indicate a very high variability in the microsatellite motifs (Table 3). At least 50 further clones will be sequenced from each species to allow the characterization of additional microsatellite repeats and their flanking sequences. Primer pairs that anneal within the flanking sequences either side of the microsatellite

repeats will be designed with the program PRIMER 3.0 (http://www.frodo.wi.mit.edu/cgi-bin/ primer3/primer3_www.cgi). Of the microsatellite motifs shown in Table 3, only the simple repeats will be investigated further: complicated nested motifs are too difficult to analyse.

These initial results suggest that Phaeocystis is genetically diverse and that this diversity can be quantified and interpreted based on the use of AFLPs and MS. With the microsatellites, we will be able to calculate gene flow around the Antarctic for P. antarctica.

Table 2 Algal species used to test best primer set and to create microsatellite-enriched libraries

Strains

Culture number,

Geographic

0 0

Post a comment