Microbial Diversity of Granules Grown in Glucosecontaining Model Wastewater Studied by FISH with Groupspecific Oligonucleotide Probes

Bacterial populations, associated with the development of aerobic granules in glucose-containing model wastewater, were monitored by a combination of FISH with rRNA-targeted fluorescence in situ hybridization with group specific probes and CLSM (Table 7.5). A column-type sequential aerobic sludge blanket reactor (SASBR) was inoculated with activated sludge from a municipal plant and fed with synthetic wastewater containing glucose as the main carbon source. The reactor biomass initially consisted of flocs that eventually developed into well-settling granules.

One of the early models of aerobic granulation involved the growth and subsequent fragmentation of filamentous fungal pellets under stressed conditions (Beun et al., 1999, 2000). These fungal fragments functioned as an immobilization matrix for colonization by floc-forming bacteria, and eventually grew out to become granules with good settling properties that were easily retained in the reactor. Based on microscopy images, Beun et al. (1999) observed the proliferation of filamentous fungal pellets during the initial stage of operation of a sequential batch reactor. These mycelial pellets would eventually expand and lyze as a result of oxygen limitation. The resulting fragments would then serve as an immobilization matrix for bacteria to attach and form microcolonies that would in turn grow into compact granules. The filamentous bacteria in the current study played a similarly important role to the filamentous fungi in the formation of aerobic granules, by facilitating floc aggregation and providing attachment sites for colonization by other microorganisms. To obtain counts of filamentous bacteria in our experiments, 50 |xl of mixed liquor sample was transferred to a clean glass slide and covered with a cover slip. An eyepiece with a single hairline was used to scan the length of the cover slip at 100 x magnification. Eleven fields of view were chosen, and for each field of view, the number of times that filamentous bacteria intersected the hairline was counted (Jenkins et al., 1993; Seviour et al., 1999). Filamentous bacteria in sludge samples were identified and categorized into taxonomic groups according to the schemes of Eikelboom and van Buisen (1981) and Jenkins et al. (1993) based on microscopy observations. Gram staining was performed using the modified Hucker method (Seviour et al., 1999).

After reactor start-up, the filament counts increased significantly from 329 ± 26 |xl-1 on day 2 to 406 ± 33 |xl-1 on day 6 and then decreased to 91 |xl-1 on day 16. Filamentous bacteria that fit the morphological descriptions of Sphaerotilus natans and Type 1701 were observed in both flocs and granules. Types 1851 and 1863 were also observed, but to a lesser extent. Filamentous bacteria probably played a role in granule formation by acting as bridges to interconnect the sludge flocs and serving as a matrix

Table 7.5. Group specific oligonucleotide probe sequences and target sites

Probe

Sequence (5'-3')

rRNA target site

Specificity

Percentage of

Reference

formamide

used

EUB 338

GCTGCCTCCCGTAGGAGT

16S,

338-355

Bacteria

20

Amann et al., 1995, 1998

EUB 338-II

GCAGCCACCCGTAGGTGT

16S,

338-355

Bacteria

20

Daims et al., 1999

EUB 338-III

GCTGCCACCCGTAGGTGT

16S,

338-355

Bacteria

20

Daims et al., 1999

ALFlb

CGTTCG(C/T)TCTGAGCCAG

16S,

19-35

a-Pr3te3bacteria

20

Manz et al., 1992

BET42a

GCCTTCCCACTTCGTTT

23S,

1027-1043

$-Pmte3bacteria

35

Manz et al., 1992

GAM42a

GCCTTCCCACATCGTTT

23S,

1027-1043

Y-Pr3te3bacteria

35

Manz et al., 1992

HGC69a

TATAGTTACCACCGCCGT

23S,

1901-1918

Actin3bacteria with high DNA G+C content

25

Roller et al., 1994

ARCH915

GTGCTCCCCCGCCAATTCCT

16S,

915-934

Archaea

20

Stahl and Amann, 1991

CF319a

TGGTCCGTGTCTCAGTAC

16S,

319-336

Cyt3phaga-Flav3bacterium

35

Manz et al., 1996

LGC354A

TGGAAGATTCCCTACTGC

16S,

354-371

Actin3bacteria with low DNA G+C content

35

Meier et al., 1999

LGC354B

CGGAAGATTCCCTACTGC

16S,

354-371

Actin3bacteria with low DNA G+C content

35

Meier et al., 1999

LGC354C

CCGAAGATTCCCTACTGC

16S,

354-371

Actin3bacteria with low DNA G+C content

35

Meier et al., 1999

for attachment of floc-forming bacteria and subsequent granule formation (Figs 7.8-7.10).

Gram-positive bacteria with high G+C content, fi-Proteobacteria, and Cytophaga-Flavobacteria were the dominant bacterial sub-populations in flocs sampled on day 2, and their relative abundance increased significantly in granules sampled on day 23 (Figs 7.11 and 7.12). Gram-positive bacteria with low G+C content and y- and a-Proteobacteria were minor constituents in the flocs and granules, while Archaea were not detected at all. The development of granules from flocs was characterized by a remarkable increase in both the cell count and area of cell coverage of high G+C gram-positive bacteria, fi-Proteobacteria, and Cytophaga-Flavobacteria. These three groups of bacteria also represented the dominant sub-populations in the flocs and granules. On the other hand, members of y-Proteobacteria, a-Proteobacteria, and low G+C gram-positive bacteria represented minor sub-population in the flocs and granules. In addition, no significant changes in relative abundances were detected for these three bacterial groups as the flocs developed into granules.

Fig. 7.8. Profile of filament counts (■, filaments ^l 1) and SVI (♦, ml g 1) during reactor operation.

Gram-positive bacteria with low G+C content were detected at relatively low abundances in this study with an equimolar mixture of LGC354A, B, and C as recommended by Meier et al. (1999). In contrast, gram-positive bacteria with high G+C content constituted in excess of 24% of Eubacteria by both cell count and cell area measures in the day 2 flocs, and this percentage exceeded 33% in day 23. Gram-positive bacteria with low G+C content includes several genera that are present in the gastrointestinal tracts and feces of humans (McCartney et al., 1996), and this group of bacterial typically constitutes a minor fraction of the bacterial population in normal conventional activated sludge systems. However, they are known to proliferate in environments with high concentrations of inorganic and organic nitrogen, such as treatment plants that process livestock wastewater or aquifers that are polluted by livestock wastewater (Cho and Kim, 2000). Several gram-positive bacteria with high G+C content isolated from activated sludge plants are known to consume soluble COD rapidly and store them as storage polymers such as glycogen (Nakamura et al., 1995; Maszenan et al., 1999, 2000a; Liu et al., 2001). This competitive advantage allows them to thrive in environments with

Fig. 7.10. Light microscopy images of aerobic flocs containing Sphaerotilus natans (a), and Types 1701 (b), 1851 (c), and 1863 (d). Scale bars for a, b, and d represent 10 ^m. Scale bar for c represents 100 ^m.

Hybridization probes

Fig. 7.11. Bacterial population enumeration using fluorescent in situ hybridization probes on day 2 (□) and day 23 (□) based on cell counts.

Hybridization probes

Fig. 7.11. Bacterial population enumeration using fluorescent in situ hybridization probes on day 2 (□) and day 23 (□) based on cell counts.

Microbial Diversity Bar

Hybridization probes

Fig. 7.12. Bacterial population enumeration using fluorescent in situ hybridization probes on day 2 (□ ) and day 23 (C) based on area of cell coverage.

Hybridization probes

Fig. 7.12. Bacterial population enumeration using fluorescent in situ hybridization probes on day 2 (□ ) and day 23 (C) based on area of cell coverage.

a low food-to-microorganism ratio. These environments would include activated sludge systems, such as the one from which seed sludge was obtained for this study, and sequential batch reactors, such as the one used in this study.

The dominance of fi-Proteobacteria in the aerobic granulation process is not surprising as this group of microorganisms, which includes the genera Comamonas, Hydrogenophaga, and Acidovorax, are frequently found in both natural and engineered systems as they are nutritionally versatile and can consume a wide array of carbon substrates (Snaidr et al., 1997). fi-Proteobacteria have also been shown to dominate the attached bacterial community during the initial development of river biofilms in a rotating annular reactor system (Manz et al., 1999). Based on this study, aerobic granulation which is another form of biofilm, is the growth of self-immobilizing bacteria occurring without supporting matrix. Filamentous bacteria fitting the morphotype description of S. natan which also hybridized with BET42a probe, with bacteria attached may have an important role in granulation. This observation is also supported by the isolation of bacterial strains growing on the sheath of S. natans, and producing enzymes capable of degrading the sheath polysaccharides moiety (Takeda et al., 2002).

Was this article helpful?

0 0

Post a comment